Journal: Life Science Alliance
Article Title: CENP-C-Mis12 complex establishes a regulatory loop through Aurora B for chromosome segregation
doi: 10.26508/lsa.202402927
Figure Lengend Snippet: (A) Strategy to generate RPE-1 cell lines expressing DSN1 WT or DSN1 ∆BM with CENP-C WT or CENP-C ∆M12BD (CC WT /DSN1 WT , CC WT /DSN1 ∆BM , CC ∆M12BD /DSN1 WT , or CC ∆M12BD /DSN1 ∆BM RPE-1 cells). mScarlet-CENP-A was also expressed in all cell lines. The DSN1 basic motif (amino acids 91–113) was deleted in DSN1 ∆BM . (B) Schematic representation of mScarlet-DSN1 cDNA targeting the endogenous DSN1 locus. To express mScarlet-tagged DSN1 wild-type (WT) or a basic motif deletion mutant (∆BM: ∆91-113) under the control of the endogenous DSN1 promoter, mScarlet-DSN1 WT or ∆BM cDNAs were targeted into the DSN1 locus by CRISPR/Cas9-mediated homologous recombination. Because the targeting constructs have blasticidin S resistance genes ( BsR ), targeted cells were selected using the selection marker. The gRNA sequence and the position of primers for genotyping are shown. (C) Genotyping PCR and immunoblotting for CC WT /DSN1 WT , CC WT /DSN1 ∆BM , CC ∆M12BD /DSN1 WT , or CC ∆M12BD /DSN1 ∆BM RPE-1 cells. Genotyping in isolated single clones was performed using the primers shown in (B). In immunoblots, DSN1 was detected by an antibody against DSN1 or mScarlet (RFP), and α-tubulin was probed as a loading control. (D) DSN1 localization in CC WT /DSN1 WT , CC WT /DSN1 ∆BM , CC ∆M12BD /DSN1 WT , and CC ∆M12BD /DSN1 ∆BM RPE-1 cells. DSN1, a subunit of the Mis12C (green), was stained with an antibody against DSN1 (green). The mScarlet-CENP-A and mScarlet-DSN1 were used as a kinetochore marker (CENP-A/DSN1, red). DNA was stained with DAPI (blue). Scale bar, 5 μm. DSN1 signal intensities at mitotic kinetochores were quantified. A representative result from two independent experiments is shown (mean and SD, one-way ANOVA with Tukey’s multiple comparison test, CC WT /DSN1 WT RPE-1 cells: n = 10 cells; CC WT /DSN1 ∆BM RPE-1 cells: n = 10 cells; CC ∆M12BD /DSN1 WT RPE-1 cells: n = 10 cells; CC ∆M12BD /DSN1 ∆BM RPE-1 cells: n = 10 cells). (E) KNL1 localization in CC WT /DSN1 WT , CC WT /DSN1 ∆BM , CC ∆M12BD /DSN1 WT , and CC ∆M12BD /DSN1 ∆BM RPE-1 cells. KNL1 was stained with an antibody against KNL1 (green). The mScarlet-CENP-A and mScarlet-DSN1 were used as a kinetochore marker (CENP-A/DSN1, red). DNA was stained with DAPI (blue). Scale bar, 5 μm. DSN1 signal intensities at mitotic kinetochores were quantified. A representative result from two independent experiments is shown (mean and SD, one-way ANOVA with Tukey’s multiple comparison test, CC WT /DSN1 WT RPE-1 cells: n = 10 cells; CC WT /DSN1 ∆BM RPE-1 cells: n = 10 cells; CC ∆M12BD /DSN1 WT RPE-1 cells: n = 10 cells; CC ∆M12BD /DSN1 ∆BM RPE-1 cells: n = 10 cells). (F) Bub1 localization in CC WT /DSN1 WT , CC WT /DSN1 ∆BM , CC ∆M12BD /DSN1 WT , and CC ∆M12BD /DSN1 ∆BM RPE-1 cells. Bub1 was stained with an antibody against Bub1 (green). The mScarlet-CENP-A and mScarlet-DSN1 were used as a kinetochore marker (CENP-A/DSN1, red). DNA was stained with DAPI (blue). Scale bar, 5 μm. Bub1 signal intensities at mitotic kinetochores were quantified. A representative result from two independent experiments is shown (mean and SD, one-way ANOVA with Tukey’s multiple comparison test, CC WT /DSN1 WT RPE-1 cells: n = 354 kinetochores from 5 cells; CC WT /DSN1 ∆BM RPE-1 cells: n = 327 kinetochores from 5 cells; CC ∆M12BD /DSN1 WT RPE-1 cells: n = 375 kinetochores from 5 cells; CC ∆M12BD /DSN1 ∆BM RPE-1 cells: n = 386 kinetochores from 5 cells). (G) Aurora B localization in CC WT /DSN1 WT , CC WT /DSN1 ∆BM , CC ∆M12BD /DSN1 WT , and CC ∆M12BD /DSN1 ∆BM RPE-1 cells. Aurora B was stained with an antibody against Aurora B (green). The mScarlet-CENP-A and mScarlet-DSN1 were used as a kinetochore marker (CENP-A/DSN1, red). DNA was stained with DAPI (blue). Scale bar, 10 μm. The insets show an enlarged single chromosome (scale bar, 2 μm). Aurora B signal intensities at inner centromeres were quantified. A representative result from two independent experiments is shown (mean and SD, one-way ANOVA with Tukey’s multiple comparison test, CC WT /DSN1 WT RPE-1 cells: n = 228 kinetochores from 5 cells; CC WT /DSN1 ∆BM RPE-1 cells: n = 221 kinetochores from 5 cells; CC ∆M12BD /DSN1 WT RPE-1 cells: n = 215 kinetochores from 5 cells; CC ∆M12BD /DSN1 ∆BM RPE-1 cells: n = 212 kinetochores from 5 cells). (H) Aurora B localization in CC WT /DSN1 WT , CC WT /DSN1 ∆BM , CC ∆M12BD /DSN1 WT , and CC ∆M12BD /DSN1 ∆BM RPE-1 cells treated with 5-ITu for 30 min. Aurora B was stained with an antibody against Aurora B (green). The mScarlet-CENP-A and mScarlet-DSN1 were used as a kinetochore marker (CENP-A/DSN1, red). DNA was stained with DAPI (blue). Scale bar, 10 μm. The insets show enlarged chromosomes (scale bar, 2 μm). Aurora B signal intensities at the kinetochore-proximal pool were quantified. A representative result from two independent experiments is shown (mean and SD, one-way ANOVA with Tukey’s multiple comparison test, CC WT /DSN1 WT RPE-1 cells: n = 387 kinetochores from 5 cells; CC WT /DSN1 ∆BM RPE-1 cells: n = 389 kinetochores from 5 cells; CC ∆M12BD /DSN1 WT RPE-1 cells: n = 381 kinetochores from 5 cells; CC ∆M12BD /DSN1 ∆BM RPE-1 cells: n = 395 kinetochores from 5 cells).
Article Snippet: We amplified DNA fragments containing T7 promoter, gRNA target sequences (intron 1: CCAACACTATAGCTGACAAG; intron 4: AAACTGATAGAGTACAGTGG), and gRNA scaffold sequences by PCR using primers shown in Table S1 and pX330 (plasmid #42230; Addgene) ( ) as a template.
Techniques: Expressing, Mutagenesis, Control, CRISPR, Homologous Recombination, Construct, Selection, Marker, Sequencing, Western Blot, Isolation, Clone Assay, Staining, Comparison
Addgene inc is a verified supplier 
